Hieff NGS™ RNA Lib Prep 384 CDI Primer for Illumina, Set 2 (96 index) -12415ES

YeasenSKU: 12415ES02

Size: 96×2T
Price:
Sale price$645.00

Shipping calculated at checkout

Stock:
In stock
Bulk Quote Inquiry

Description

Hieff NGS® RNA Lib Prep 384 CDI Primer for Illumina is a dedicated linker primer kit for RNA library construction of the Illumina high-throughput sequencing platform, divided into 2 Sets, each Set contains the PE adapter used in the second-generation sequencing library and 8 of i5 Index Primer and 12 of i7 Index Primer. A total of 16 of i5 Index Primers and 24 of i7 Index Primers are available in 2 Sets which make 384 different combinations of double-ended index-labeled libraries can be constructed. All reagents provided in the kit undergo rigorous quality control and functional verification to maximize library construction stability and repeatability.

Components

No.

Name

Volume

12414ES02

PE Adapter

320 μL

RP 501-508

60 μL each

RP 701-712

40 μL each

12415ES02

PE Adapter

320 μL

RP 509-516

60 μL each

RP 713-724

40 μL each


Shipping and Storage

All the components are shipped with dry ice and can be stored at -15℃~ -25℃ for 18 months.

Note:

1) The concentration of PE Adapter in this kit is 15 μM, and the amount of adapters used for individual library construction is adjusted according to the recommended amount of library construction kit. Index Primer has a concentration of 10 μM.

2) The PE Adapter provided with this kit is a general-purpose short adapter that requires PCR amplification to obtain a complete library. Index Primer provides Barcode sequence tags for distinguishing samples during high-throughput sequencing.

3) Each set of this kit contains 8 of i5 Index Primers (RP 5xx) and 12 of i7 Index Primers (RP 7xx), which can be combined with each other to construct 96 different combinations of double-ended Index labeled libraries. 2 Sets offer a total of 16 of i5 Index Primers and 24 of i7 Index Primers. You can use the i5 Index Primer (or i7 Index Primer) from Cat#12414 and the i7 Index Primer (or i5 Index Primer) in Cat#12415 to build up to 384 different combinations of double-ended Index labeled libraries.

4) Do not heat the adapter, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. The adapters are need to avoid repeated freeze-thaw, and it is recommended to store it in aliquots and store it at 4°C for a short time.

5) The sequencing library structure constructed using the Hieff NGS® RNA 384 CDI Primer for Illumina® kit is as follows:



6) For your safety and health, please wear a lab coat and wear disposable gloves.
7) This product is for scientific research purposes only!

Instructions
1. Use of adapters: Dilute to an appropriate concentration according to the recommended dosage for different input amounts in the library construction manual used.
2. Use of Index Primer: Prepare the reaction system according to the library construction manual Chinese the library amplification system (as shown in the table below), and the reaction procedure is set according to the procedure in the library construction manual.

 

Name

Volume(μL)

2× High Fidelity DNA PCR Mix

25

RP 5xx

2.5

RP 7xx

2.5

Adapter Ligated DNA

20

Total

50

 

Sequence Information

PE Adapter for Illumina:

5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´

5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i5 Index Primer for Illumina:

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´

i7 Index Primer for Illumina:

5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´

[i5 Index]8 bp of i5 Index seqience,[i7 Index]8 bp of i7 Index sequence.

The Index name corresponding to each primer, the Index sequence contained in the primer, and the corresponding Index sequence information during sequencing are shown in the following table:

 

I5 Index Name

I5 Index

sequence

Index sequence information during sequencing

NovaSeq 6000 v1.0 reagents, MiSeq, HiSeq 2000/2500

NovaSeq 6000 v1.5 reagents

MiniSeq, NextSeq,
HiSeq 3000/4000

RP501

TATAGCCT

TATAGCCT

AGGCTATA

RP502

ATAGAGGC

ATAGAGGC

GCCTCTAT

RP503

CCTATCCT

CCTATCCT

AGGATAGG

RP504

GGCTCTGA

GGCTCTGA

TCAGAGCC

RP505

AGGCGAAG

AGGCGAAG

CTTCGCCT

RP506

TAATCTTA

TAATCTTA

TAAGATTA

RP507

CAGGACGT

CAGGACGT

ACGTCCTG

RP508

GTACTGAC

GTACTGAC

GTCAGTAC

RP509

GACCTGTA

GACCTGTA

TACAGGTC

RP510

ATGTAACT

ATGTAACT

AGTTACAT

RP511

GTTTCAGA

GTTTCAGA

TCTGAAAC

RP512

CACAGGAT

CACAGGAT

ATCCTGTG

RP513

TAGCTGCC

TAGCTGCC

GGCAGCTA

RP514

AGCGAATG

AGCGAATG

CATTCGCT

RP515

TATGCTGC

TATGCTGC

GCAGCATA

RP516

AGAAGACT

AGAAGACT

AGTCTTCT

 

 

 

I7 Index Name

I7 Index sequence

Index sequence information during sequencing

RP701

CGAGTAAT

ATTACTCG

RP702

TCTCCGGA

TCCGGAGA

RP703

AATGAGCG

CGCTCATT

RP704

GGAATCTC

GAGATTCC

RP705

TTCTGAAT

ATTCAGAA

RP706

ACGAATTC

GAATTCGT

RP707

AGCTTCAG

CTGAAGCT

RP708

GCGCATTA

TAATGCGC

RP709

CATAGCCG

CGGCTATG

RP710

TTCGCGGA

TCCGCGAA

RP711

GCGCGAGA

TCTCGCGC

RP712

CTATCGCT

AGCGATAG

RP713

CCTACACG

CGTGTAGG

RP714

GTAGTGTC

GACACTAC

RP715

TGTATGCA

TGCATACA

RP716

CCAGACTG

CAGTCTGG

RP717

AGGTGCCA

TGGCACCT

RP718

TCACCTTG

CAAGGTGA

RP719

GTATCTTT

AAAGATAC

RP720

CAGCTCCA

TGGAGCTG

RP721

TCGCCTTA

TAAGGCGA

RP722

CTAGTACG

CGTACTAG

RP723

AGCGTAGC

GCTACGCT

RP724

GAGCCTCG

CGAGGCTC


Yeasen Inquiry

You may also like