TelN Protelomerase (5 U/μL)-14540ES

YeasenSKU: 14540ES72

Size: 250 U
Price:
Sale price$65.00

Shipping calculated at checkout

Stock:
In stock
Bulk Quote Inquiry

Description

TelN Protelomerase is a recombinant expression from phage N15. It cuts double-stranded DNA (dsDNA) at TelN recognition sequences (56 bp), and generates covalently closed ends at the cleavage sites, which can be applied to enzymatic synthesis of DNA.

Specifications

Cat.No.

14540ES72 /14540ES80 / 14540ES90

Size

250U / 1000 U / 5000 U

Unit Definition

One unit is defined as the amount of enzyme that will convert 0.5 μg of supercoiled plasmid containing telN recognition sites into closed linear dsDNA, in 20 μL reaction system containing 1 X TelN Reaction Buffer at 30℃ for 30 minutes.

Recognition Sites

TATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGTGCTGATA

ATAGTCGTGTGTTAACGGGTAATATGCGCGCATATTACCTGATAACACACGACTAT

Heat Inactivation

75℃ for 5 min

 

Components

Components No.

Name

14540ES72

14540ES80

14540ES90

14540-A

TelN Protelomerase (5 U/μL)

50 μL

200 μL

1 mL

14540-B

10 X TelN Reaction Buffer

250 μL

1 mL

5 X 1 mL

Storage

This product should be stored at -25~-15℃ for 1 years.

Instructions

1. Reaction system preparation

Components

Volume (μL)

dsDNA (< 300 fmol of TelN sites)

X

10 X TelN Reaction Buffer

2

TelN Protelomerase (5 U/μL)

1

Nuclease-free water

To 20

2. Reaction condition: 30℃ for 30 min after mixing well.

3. Heat inactivation: 75℃ for 5 min.

 Notes

1. This product is for research use only.

2. Please operate with lab coats and disposable glovesfor your safety.


You may also like

Inquiry